m13 forward Search Results


94
Danaher Inc m13
M13, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pm30326452-78-17-22?v=Danaher+Inc
Average 94 stars, based on 1 article reviews
m13 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

90
Bio-Serv m13 forward primer
M13 Forward Primer, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pmc03565871-65-8-11?v=Bio-Serv
Average 90 stars, based on 1 article reviews
m13 forward primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega m13 universal sequencing primers
M13 Universal Sequencing Primers, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pm12452967-73-9-13?v=Promega
Average 90 stars, based on 1 article reviews
m13 universal sequencing primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Amplicon Express puc18-m13 reverse
Puc18 M13 Reverse, supplied by Amplicon Express, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/10__1128_slash_aem__70__8__4864___4871__2004-80-18-24?v=Amplicon+Express
Average 90 stars, based on 1 article reviews
puc18-m13 reverse - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
SibEnzyme ltd forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30)
Forward And Reverse M13 Primers (F: 50 Gttttcccagtcacgacgttg 30 And R: 50 Tg Agcggataacaatttcacacag 30), supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pm21476042-76-15-34?v=SibEnzyme+ltd
Average 90 stars, based on 1 article reviews
forward and reverse m13 primers (f: 50 gttttcccagtcacgacgttg 30 and r: 50 tg agcggataacaatttcacacag 30) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent m13 forward primers
M13 Forward Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/us08513002-490-0-20?v=Midland+Certified+Reagent
Average 90 stars, based on 1 article reviews
m13 forward primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert,
M13 Forward Primers Complementary To The Known Pbluescript® Sequence, Located Next To The Genomic Dna Insert,, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/us06972173-372-14-19?v=Midland+Certified+Reagent
Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence, located next to the genomic dna insert, - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega forward m13-f primer
Forward M13 F Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pmc04429320-52-27-37?v=Promega
Average 90 stars, based on 1 article reviews
forward m13-f primer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Commonwealth Biotechnologies Inc m13 forward primers
M13 Forward Primers, supplied by Commonwealth Biotechnologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pm10844655-282-12-21?v=Commonwealth+Biotechnologies+Inc
Average 90 stars, based on 1 article reviews
m13 forward primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent m13 forward primers complementary to the known pbluescript® sequence
M13 Forward Primers Complementary To The Known Pbluescript® Sequence, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/us08513002-490-7-20?v=Midland+Certified+Reagent
Average 90 stars, based on 1 article reviews
m13 forward primers complementary to the known pbluescript® sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ecogenics GmbH m13-tailed forward primers
M13 Tailed Forward Primers, supplied by Ecogenics GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pmc04222548-115-29-9?v=Ecogenics+GmbH
Average 90 stars, based on 1 article reviews
m13-tailed forward primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Bioarray Inc m13 forward (−20) 13 reverse primers
M13 Forward (−20) 13 Reverse Primers, supplied by Bioarray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m13+forward/pm24813267-88-14-27?v=Bioarray+Inc
Average 90 stars, based on 1 article reviews
m13 forward (−20) 13 reverse primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results